¡¡¡TODOS A CANTAR!!!.

¿Listos?

Comentarios

Sarinha dijo…
jajaja, Gaby, te has librado porque son cachorros, si llegan a ser perros grandes me muero del ascoooo. Un besito.
P´PITO dijo…
bieeeeeeeeeeennnnnnnnnnn por esos perritos.....

no me puse a cantar porque estaba en la oficina pero ora veras cuando llegue a la casa!!!!!

jajajajajaja
saludos.........
A.- dijo…
¿Qué tienen contra los perros grandes? si todos son una belleza!!!
Dicho eso, te cuento, Gaby, que yo sí canté...pero creo que la pronunciación no me quedó muy bien que digamos ¡al menos lo intenté y me divertí!
¡¡Bellísimo video!!

Un beso!
Victoria dijo…
Qué grandes artistas son estos peludos que siempre nos acompañan y tanto nos quieren.
Besitos
anapedraza dijo…
A mi me dan mucha ternura los perritos, lo malo es que me recuerda Navidad y me entra una mala lecheee.....

Saludos.

MIGUEL
Bort dijo…
ya me imagino la tortura que debieron haber sufrido esos pobres animales para grabar ese video...


pobres... forzandolos contra su voluntad y esque... quien querria ladrar eso ???

joojojoj JAJAJJA MUY CHISTOSO!!! curioso tambien,!!! le gustó a mi amiga!!!!

dijo algo asi como: HAAAAAAAAAAAAAAAAAAAAAAAAAAAAYY!!! TEEEEERNUUURRRRRIITTAAAAA!!!
Vizarro Man dijo…
EEEEEHHHYYYYYY!!! TRANQUILOS CON RODOLFO EL RENO!!!!!!, es mi cancion favorita desde los siglos antepasados!!!!, y ta muy mono el vidio!!!!, y me vale pero si me la pase ladrando como perro y que??? eeehhh!!!!!??? alguien me la hace de pexx?????............ buenoooo!!!!! asi me gusta que se respete a Lord Vizarro, jum!, jojojoojo, saludotesss aburridoootaaaa!!!!!!
El_Sonriente dijo…
GUAGUAGUAGUAGUAGUAGUAGU XD jajaja
me bajare el disco ese jajaja

Saludos.
son preciosos!!!!
pero algunos desafinaron XD
saludos!!
Gaby dijo…
Sara: ¡Como eres!, chicos o grandes los perros son divinos. :)

P'pito: ¡Tenias que haber invitado a todos tus compañeros de la oficina y hacer coros!. ;D

A: ¡Así me gusta señorita!, olvidate de la pronunciación... a mi tampoco se me da bien. ;P

Victoria: ¡Claro que si!. :)

Miguel: No te preocupes, en este blog le damos duro y tupido a la Navidad. :P

Bort: Me alegra que a tu amiga le gustara el video... ¿CONQUE USANDO MI BLOG PARA LIGAR?... VOY A COBRARTE COMISIÓN. jajajajaja

Don Vizarro: Así me gusta caballero, a defender sus derechos. ;D

Lo siento Sonriente... ¡¡Esta agotado!!. :)

Kakoketa: ¡Pero que exigente eres mujer!. ;P
El Ente dijo…
jajajaja esto es la cancion del verano? jajjaja

Besosssssssssssss

guau guau guau
Miss Adore dijo…
Jajajajaajaja! Pues la verdad es que cuando comencé a cantar, los vecinos llegaron a tocarme la puerta, y no precisamente para unírseme y cantar.

Que video más divertido! Seguramente lo grabó Cruela Devil o algo así... jaja

Besos,
Miss :)
eMeBucio dijo…
Me parece que alguien se divirtio mucho haciendo ese video...
Es una ternura!!

y los condones?
Paolita dijo…
todos con sus trajes navideños q ternura, le voy acomprar un gorro a mi gatito
Rous dijo…
aaaaaahhhhhhh me acabas de hacer el diaaaaa!!!!1 que lindos perritos quiero uno de cada unoooo sobre todo el blanquito :D gracias Gabyblinda y hasta ahorita pude venir por que andaban rondando mi oficina y no podia ver el videito :D
Mary Lovecraft dijo…
no Ente, es la canción del invierno!! xd xd xd

pero quéeeeeee monoooooossss y ricos!!

:D
Warrior dijo…
Que monada xD.
pOR Cierto a mi me encantan los perros grandes como los pastores (lo digo por el primer comentario).
Merce dijo…
Que bonita la cancion, y el gato??? que tranquilo que está en medio de tanto perro. Hace muy buen acompañamiento :)

Muuuuy bonito Gaby, esta la guardo para mis niñas :)

Biquiños.
Agustín dijo…
jajaja menos mal que no hay que adivinar la cancion, porque sino estoy frito jajajaja, muy bonito el video ;)

saludetes!!
Caliani dijo…
jajaja las mascotas de los duendes d papanoé! que kuko ^^
CaZp dijo…
si sabia enviaba a mi perrito que canta bajo la ducha =)
Bort dijo…
OJOJOOJOOJ


cuando tu blog me consiga novia, te compró un dominio!!!
Sasori dijo…
más peligroso que el tigre de santa julia O_O
Carmen dijo…
Qué tieeeernoooo!!!
Me ha gustado mucho verlos

Besos y que tengas un lindo miércoles
Balovega dijo…
Desafinaron y hoy llueve... guaaaa... un saludo
VolVoreta dijo…
No entiendo por qué no se grabó mi comment ayer..

Te decía que no canto nada bien por lo que bailaré un poquito...por aportar algo :)
Un besito
senovilla dijo…
Por qué será que los que más han cantado son mis peques,ja,ja,ja.

Saludos Cordiales.
Esta muy conseguido..jajaja, y que pasada de guaperas....preciosos, pequeños y/o grandes...son geniáles
Un abrazote

Entradas más populares de este blog

ADIVINANZA DIFICIL.

CARTA A MI HERMANO.

EL GRITO DE INDEPENDENCIA.